View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3815_high_9 (Length: 273)
Name: NF3815_high_9
Description: NF3815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3815_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 99 - 256
Target Start/End: Original strand, 38446002 - 38446159
Alignment:
| Q |
99 |
ttgagaaacaaatccaaaaacaaatagggtgcatgtcaggtttctttcacatcttcgatcgccacccaggaaaacgcatctactccgttaaaagactccc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446002 |
ttgagaaacaaatccaaaaacaaatagggtgcatgtcaggtttctttcacatcttcgatcgccacccaggaaaacgcatctactccgttaaaagactccc |
38446101 |
T |
 |
| Q |
199 |
ttcttcaatatcaacggtatcaattcattcattcatatcatactttcactctcatact |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446102 |
ttcttcaatatcaacggtatcaattcattcattcatatcatactttcactctcatact |
38446159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 38445904 - 38445935
Alignment:
| Q |
1 |
gaacagaatgtgagaaactcttcacaatattg |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38445904 |
gaacagaatgtgagaaactcttcacaatattg |
38445935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University