View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3815_low_1 (Length: 557)
Name: NF3815_low_1
Description: NF3815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3815_low_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 7e-38; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 18 - 114
Target Start/End: Complemental strand, 45365941 - 45365845
Alignment:
| Q |
18 |
acgtggttcccactttgctccttccaccatcatttaaaagaagaaacccacatgttgctatactgtaaattggatagttatattatggtagggaagg |
114 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| ||||||||| |
|
|
| T |
45365941 |
acgtggttcccactttgctccttccgccatcatttaaaagaagaaacccacatgttgctatactgtaaattggatagtaatatcatgttagggaagg |
45365845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 45365816 - 45365763
Alignment:
| Q |
144 |
actggtgaagaggtgggaagcttctagtatgtgtcttagtttgattttaatatg |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45365816 |
actggtgaagaggtgggaagcttctagtatgtgtcttagtttgattttaatatg |
45365763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 48989758 - 48989836
Alignment:
| Q |
30 |
ctttgctccttccaccatcatttaaaagaagaaacccacatgttgctatactgtaaattggatagttatattatggtagg |
109 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||| | || |||||||||| |||| ||||||||||| ||||||||||||| |
|
|
| T |
48989758 |
ctttgctgcatccaccatcattttaaagaagaagctcatatgttgctat-ctgtgaattggatagtcatattatggtagg |
48989836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 283 - 320
Target Start/End: Complemental strand, 45365677 - 45365640
Alignment:
| Q |
283 |
gaactacatacacatattgtttaaaatttgtgatgtac |
320 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45365677 |
gaactacagacacatattgtttaaaatttgtgatgtac |
45365640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 323 - 369
Target Start/End: Complemental strand, 45365623 - 45365577
Alignment:
| Q |
323 |
ttaatttgtatgtaaggatattcttgtcatttgcaaaataatattaa |
369 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||| ||| ||||||||| |
|
|
| T |
45365623 |
ttaacttgtatgtagggatattcttgtcatttgtaaagtaatattaa |
45365577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 30 - 109
Target Start/End: Original strand, 36759964 - 36760042
Alignment:
| Q |
30 |
ctttgctccttccaccatcatttaaaagaagaaacccacatgttgctatactgtaaattggatagttatattatggtagg |
109 |
Q |
| |
|
||||||| | ||||||||||||| ||||||||| | || |||||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
36759964 |
ctttgctgcatccaccatcatttcaaagaagaagctcatatgttgctat-ttgtgaattggatagtcatattatggtagg |
36760042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 324 - 369
Target Start/End: Original strand, 38680756 - 38680801
Alignment:
| Q |
324 |
taatttgtatgtaaggatattcttgtcatttgcaaaataatattaa |
369 |
Q |
| |
|
||||||||||||| |||| || ||||| |||||||||||||||||| |
|
|
| T |
38680756 |
taatttgtatgtagggatgttattgtcgtttgcaaaataatattaa |
38680801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University