View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3815_low_13 (Length: 237)
Name: NF3815_low_13
Description: NF3815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3815_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 558991 - 558801
Alignment:
| Q |
17 |
ttggttttctataa-catttcttcaatgactaatcttattggagacatgtcaaatatttaacatgaatatctctttgtcataatttaaatttttagttcg |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
558991 |
ttggttttctataaacatttcttcaatgactaatcttattggagacatgtcaaatatttaacatgaatatctcttagtcataatttaaatttttagttcg |
558892 |
T |
 |
| Q |
116 |
tcggattttgaggttttagctcttttgctagacctaactaagttggtgattaaatccaatttttaagaaagaataaaatggaattggctcg |
206 |
Q |
| |
|
||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
558891 |
tcgaattttgagggtttagctcttttgctagacctaactaagttggtgattaaatccaatttttaagaaagaataaaatggaattggctcg |
558801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University