View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3815_low_14 (Length: 231)
Name: NF3815_low_14
Description: NF3815
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3815_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 215
Target Start/End: Original strand, 30342697 - 30342899
Alignment:
| Q |
13 |
atcataggtcctccaactgcttcatatcttcgtattggatctctcagttgaacaacaaacattaatgtgatatttgatagttcatcaatatcagaacttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30342697 |
atcataggtcctccaactgcttcatatcttcgtattggatctctcagttgaacaacaaacattaatgtgatatttgatagttcatcaatatcagaacttg |
30342796 |
T |
|
| Q |
113 |
cattagtgtttttagagctttggtctctaatccaatcctcaagtgaaatagcagaactcaatagatctttttctttgttcccttctttgactgaagaaac |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30342797 |
cattagtgtttttagagctttggtctctaatccaatcctcaagtgaaatagcagaactcaatagatctttttctttgttcccttctttgactgaagaaac |
30342896 |
T |
|
| Q |
213 |
ttc |
215 |
Q |
| |
|
||| |
|
|
| T |
30342897 |
ttc |
30342899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 128 - 182
Target Start/End: Complemental strand, 45029854 - 45029800
Alignment:
| Q |
128 |
agctttggtctctaatccaatcctcaagtgaaatagcagaactcaatagatcttt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
45029854 |
agctttggtctctaatccaatcctcaagtggaatagcagaagccaaaagatcttt |
45029800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University