View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3817_high_2 (Length: 360)
Name: NF3817_high_2
Description: NF3817
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3817_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 129 - 358
Target Start/End: Original strand, 34899746 - 34899975
Alignment:
| Q |
129 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899746 |
gtcagtgatatcatctgcacaaattcacataaaattttgtagttggaagatacatacctttcatgtttggtgagaatggaaggaaaattttgagactata |
34899845 |
T |
|
| Q |
229 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899846 |
aggttgcatacacgcaggggaagacacaatttagcttttgttgacatcaaatagcgagagaagaactaaagagagatgtgtttatatgcatataggtaaa |
34899945 |
T |
|
| Q |
329 |
gtttggtagtttcaactttcaagttgagat |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34899946 |
gtttggtagtttcaactttcaagttgagat |
34899975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 9 - 75
Target Start/End: Original strand, 43075178 - 43075244
Alignment:
| Q |
9 |
agcagagaggtacagaagagaatgaaagtgaaaatggtgtgaaagggaagaaggaatggaccactga |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43075178 |
agcagagaggtacagaagagaatgaaagtgaaaatggtgtgaaagggaagaaggaatggaccactga |
43075244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University