View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3818_high_12 (Length: 205)
Name: NF3818_high_12
Description: NF3818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3818_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 193
Target Start/End: Original strand, 35243516 - 35243688
Alignment:
| Q |
21 |
aatggtaattggcttcatttctaaagtttgattgatcttgaacacatagtgaagcttctctttctgtatttgatatagcccacattgaatgaaccgcgta |
120 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35243516 |
aatgataattggcttcatttctaaagtttgattgatcttgaacacatagtgaagcttctctttctgtatttgatataggtcacattgaatgaaccgcgta |
35243615 |
T |
 |
| Q |
121 |
aatcttgtgtgcccgttctctttgttttgcaatgtttggttttcggcttgttatgtgtttgtgttatattctt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35243616 |
aatcttgtgtgcccgttctctttgttttgcaatgtttggttttcggcttgttatgtgtttgtgttatattctt |
35243688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University