View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3818_low_12 (Length: 205)

Name: NF3818_low_12
Description: NF3818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3818_low_12
NF3818_low_12
[»] chr3 (1 HSPs)
chr3 (21-193)||(35243516-35243688)


Alignment Details
Target: chr3 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 21 - 193
Target Start/End: Original strand, 35243516 - 35243688
Alignment:
21 aatggtaattggcttcatttctaaagtttgattgatcttgaacacatagtgaagcttctctttctgtatttgatatagcccacattgaatgaaccgcgta 120  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||    
35243516 aatgataattggcttcatttctaaagtttgattgatcttgaacacatagtgaagcttctctttctgtatttgatataggtcacattgaatgaaccgcgta 35243615  T
121 aatcttgtgtgcccgttctctttgttttgcaatgtttggttttcggcttgttatgtgtttgtgttatattctt 193  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35243616 aatcttgtgtgcccgttctctttgttttgcaatgtttggttttcggcttgttatgtgtttgtgttatattctt 35243688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University