View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3818_low_3 (Length: 502)
Name: NF3818_low_3
Description: NF3818
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3818_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 4e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 347 - 484
Target Start/End: Original strand, 23621892 - 23622029
Alignment:
| Q |
347 |
aggtattttagtgtatgacttacttgcattatacagatttttgtaaaggtgattaaaagtaactgttttcaaattattccgcatttagagtttgaaattt |
446 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23621892 |
aggtattttagtgtctgacttacttgcattatacagatttttgtaaaggtgattaaaagtaactgttttcaaattattccgcatttagagtttgaaattt |
23621991 |
T |
|
| Q |
447 |
caccactaccggtctgaaaattgagatgttacaatatt |
484 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23621992 |
caccactaccgctctgaaaattgagatgttacaatatt |
23622029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 370 - 484
Target Start/End: Original strand, 23617913 - 23618027
Alignment:
| Q |
370 |
ttgcattatacagatttttgtaaaggtgattaaaagtaactgttttcaaattattccgcatttagagtttgaaatttcaccactaccggtctgaaaattg |
469 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||| |||||||||||||| | ||||||||||| |||||||||||| |||| || |||| ||| |
|
|
| T |
23617913 |
ttgcattatacagatttttgtaaaggcgattaagagtaatggttttcaaattatttcaaatttagagtttaaaatttcaccaccaccgctccgaaagttg |
23618012 |
T |
|
| Q |
470 |
agatgttacaatatt |
484 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
23618013 |
agatgttacaatatt |
23618027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University