View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3819_low_4 (Length: 314)
Name: NF3819_low_4
Description: NF3819
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3819_low_4 |
 |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 52; Significance: 8e-21; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 166 - 241
Target Start/End: Complemental strand, 45551072 - 45550997
Alignment:
| Q |
166 |
tcttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||| |||||| || ||||||||||| |||||||| |
|
|
| T |
45551072 |
tctttttgtcaaaatgaaaaggtgttggttgctaaaatagaccttcatgaaattgagtgggtctattgtagcaaac |
45550997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 166 - 241
Target Start/End: Original strand, 45551799 - 45551874
Alignment:
| Q |
166 |
tcttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||| |||||| || ||||||||||| |||||||| |
|
|
| T |
45551799 |
tctttttgtcaaaatgaaaaggtgttggttgctaaaatagaccttcatgaaattgagtgggtctattgtagcaaac |
45551874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 5995316 - 5995252
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
5995316 |
aaatgaaaaggtgttggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
5995252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 41970948 - 41970887
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
41970948 |
tgaaaaggtgttggttgctaaaatagatcttcatgaaaatgagtgggtctattgtagcaaac |
41970887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 5997619 - 5997680
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
5997619 |
tgaaaaggtgctggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
5997680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 232
Target Start/End: Original strand, 28778109 - 28778159
Alignment:
| Q |
182 |
aaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctatt |
232 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
28778109 |
aaaaggtgttggtcgctaaaatagaccttgatgaaaatgagtgggtctatt |
28778159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 27268250 - 27268312
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaact |
242 |
Q |
| |
|
|||||||||| || ||||||||||||| ||| ||||||||| |||| |||||| || |||||| |
|
|
| T |
27268250 |
tgaaaaggtgctgattgctaaaatagaccttcatgaaaatgagtggatctattgtatcaaact |
27268312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 7)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 19237611 - 19237672
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
19237611 |
tgaaaaggtgttggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
19237672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 168 - 240
Target Start/End: Original strand, 8683853 - 8683924
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
|||||||| |||| ||||| ||||||||||||||||||| ||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
8683853 |
ttttggtccaaat-aaaagatgttggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaa |
8683924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 180 - 240
Target Start/End: Original strand, 17280707 - 17280767
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| ||||||| ||| ||||||| |
|
|
| T |
17280707 |
tgaaaaggtgttggttgctaaaatagaccttaatgaaaatgagtgggtcaattgtagcaaa |
17280767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 168 - 241
Target Start/End: Complemental strand, 5860622 - 5860549
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||| ||| ||||||||| ||||| |||||||||||| | ||| || |||||| ||||||||||| |||||||| |
|
|
| T |
5860622 |
tttttgtccaaatgaaaatgtgtttgttgctaaaatacaccttcataaaaatgagtgggtctattgtagcaaac |
5860549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 206
Target Start/End: Complemental strand, 25359571 - 25359533
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaataga |
206 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
25359571 |
ttttggtccaaataaaaaggtgttggttgctaaaataga |
25359533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 10793587 - 10793648
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| || ||| | ||||||||||| |||||||| |
|
|
| T |
10793587 |
tgaaaaggtgttgcttgctaaaatagaccttgataaaatggagtgggtctattgtagcaaac |
10793648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 10792546 - 10792482
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| || ||| | |||||||||| |||||||| |
|
|
| T |
10792546 |
aaatgaaaaggtgttgcttgctaaaatagaccttcataaaatggaatgggtctattgtagcaaac |
10792482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 7)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 30972011 - 30972075
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||| || ||||||||||| |||||||| |
|
|
| T |
30972011 |
aaatgaaaaggtgttggttgctaaaatagaccttcatgaaattgagtgggtctattgtagcaaac |
30972075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 16106032 - 16106093
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
16106032 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
16106093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 16113272 - 16113333
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
16113272 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
16113333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 180 - 240
Target Start/End: Complemental strand, 30971345 - 30971285
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
|||||| ||| |||||||||||||||| ||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
30971345 |
tgaaaaagtgatggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaa |
30971285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 241
Target Start/End: Original strand, 5152445 - 5152522
Alignment:
| Q |
164 |
gatcttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||| ||| || |||||| | ||||||||| |||||||| |
|
|
| T |
5152445 |
gatcttttggtccaaatgaaaaggtgccacttgctaaaatagaccttcataaaaatgagcgggtctattgtagcaaac |
5152522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 16101583 - 16101522
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| ||| ||||||| |||||||| |
|
|
| T |
16101583 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagtgtgtctattgtagcaaac |
16101522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 220
Target Start/End: Complemental strand, 32744070 - 32744030
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatg |
220 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
32744070 |
tgaaaaggtgttggttgctaaaatagaccttcataaaaatg |
32744030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 1e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 177 - 241
Target Start/End: Complemental strand, 33471228 - 33471164
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||| |||||||||| |||||||| |
|
|
| T |
33471228 |
aaatgaaaaggtgttggttgctaaaatagaccttcatgaaaatgaatgggtctattgtagcaaac |
33471164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 22671666 - 22671606
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| ||||||||| ||||||| ||| |||||||| |
|
|
| T |
22671666 |
tgaaaaggtgttggttgttaaaatagaccttcatgaaaatgagtgggtc-attgtagcaaac |
22671606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 45; Significance: 1e-16; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 40929850 - 40929926
Alignment:
| Q |
165 |
atcttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||| | ||| || |||||| ||||||||||| |||||||| |
|
|
| T |
40929850 |
atcttttcgtccaaatgaaaaggtgttggttgctaaaataaaccttcataaaaatgagtgggtctattgtagcaaac |
40929926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 4300993 - 4300932
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||| ||||||||||| |||||||| |
|
|
| T |
4300993 |
tgaaaaggtgttggttgctaaaatagatcttcatgaaaataagtgggtctattgtagcaaac |
4300932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 27359843 - 27359904
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
27359843 |
tgaaaaggtgttgtttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
27359904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 54285820 - 54285884
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||| || |||||| ||||||||||| |||||||| |
|
|
| T |
54285820 |
aaatgaaaaggtgtaggttgctaaaatagaccttcataaaaatgagtgggtctattgtagcaaac |
54285884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 178 - 241
Target Start/End: Original strand, 27317481 - 27317544
Alignment:
| Q |
178 |
aatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||| ||||||||||| | ||| ||||||||| | ||||||||| |||||||| |
|
|
| T |
27317481 |
aatgaaaaggtgttgcttgctaaaataaaccttcatgaaaatgagcgggtctattgtagcaaac |
27317544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 174 - 241
Target Start/End: Original strand, 28422847 - 28422914
Alignment:
| Q |
174 |
tcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||| |||||||||| |||||||||||||||| || || |||||| ||||||||||| |||||||| |
|
|
| T |
28422847 |
tcaaagtgaaaaggtgatggttgctaaaatagactttcataaaaatgagtgggtctattgtagcaaac |
28422914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 238
Target Start/End: Original strand, 17619152 - 17619210
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagca |
238 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||| ||||||||||| ||||| |
|
|
| T |
17619152 |
tgaaaaggtactggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagca |
17619210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 182 - 240
Target Start/End: Complemental strand, 51341932 - 51341874
Alignment:
| Q |
182 |
aaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
||||||||||||||| ||||||||| ||| |||| |||| || |||||||| ||||||| |
|
|
| T |
51341932 |
aaaaggtgttggttgttaaaatagaccttcatgagaatgagtaggtctattgtagcaaa |
51341874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 1e-16; HSPs: 7)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 180 - 240
Target Start/End: Original strand, 5483922 - 5483982
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
5483922 |
tgaaaaggtgttggatgctaaaatagacctttatgaaaatgagttggtctattatagcaaa |
5483982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 18767577 - 18767638
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||||| ||| ||||||| |||||||| |
|
|
| T |
18767577 |
tgaaaaggtgttggttgctaaaatagacctttataaaaatgagtgagtctattgtagcaaac |
18767638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 180 - 242
Target Start/End: Original strand, 16591534 - 16591596
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaact |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||| | |||||||||| ||||||||| |
|
|
| T |
16591534 |
tgaaaaggtgttggttgctaaaatagaccttcatgaaattaaatgggtctattgtagcaaact |
16591596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 9244304 - 9244252
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctatt |
232 |
Q |
| |
|
|||||||||||||| |||||||||||| ||| || |||||| ||||||||||| |
|
|
| T |
9244304 |
tgaaaaggtgttggatgctaaaatagaccttcataaaaatgagtgggtctatt |
9244252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 168 - 203
Target Start/End: Complemental strand, 32666383 - 32666348
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaat |
203 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32666383 |
ttttggtctaaatgaaaaggtgttggttgctaaaat |
32666348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 194 - 241
Target Start/End: Original strand, 39240876 - 39240923
Alignment:
| Q |
194 |
ttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
39240876 |
ttgctaaaatagaccttcatgaaaatgggtgggtctattgtagcaaac |
39240923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 182 - 235
Target Start/End: Complemental strand, 29558209 - 29558157
Alignment:
| Q |
182 |
aaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattata |
235 |
Q |
| |
|
|||||||||||||||||||| |||| ||| || |||||| |||||||||||||| |
|
|
| T |
29558209 |
aaaaggtgttggttgctaaa-tagaccttcataaaaatgagtgggtctattata |
29558157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 18)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 31135230 - 31135168
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaact |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| || |||||||| ||||||||| |
|
|
| T |
31135230 |
tgaaaaggtgttggttgctaaaatagaccttcatgaaaatgagttggtctattgtagcaaact |
31135168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 241
Target Start/End: Complemental strand, 23088332 - 23088275
Alignment:
| Q |
184 |
aaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
23088332 |
aaggtgttggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
23088275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 23089278 - 23089339
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||| ||||||||||| |||||||| |
|
|
| T |
23089278 |
tgaaaaggtgttggttgctaaaatagacctacatgaaaatgagtgggtctattgtagcaaac |
23089339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 31914583 - 31914522
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
31914583 |
tgaaaaggtgctggttgctaaaatagatcttcatgaaaatgagtgggtctattgtagcaaac |
31914522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 180 - 242
Target Start/End: Complemental strand, 20627587 - 20627525
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaact |
242 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||| ||||||||||| ||||||||| |
|
|
| T |
20627587 |
tgaaaaggtgttgggtgctaaaatagactttcatgaaaatgagtgggtctattgtagcaaact |
20627525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 178 - 240
Target Start/End: Original strand, 48315191 - 48315253
Alignment:
| Q |
178 |
aatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||||||||||| ||||||||||| ||||||| |
|
|
| T |
48315191 |
aatgaaaaggtgttgcttgctaaaataaacctttatgaaaataagtgggtctattgtagcaaa |
48315253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 34837979 - 34838040
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||| |||||||||||||||||| ||||| || |||||| ||||||||||| |||||||| |
|
|
| T |
34837979 |
tgaaaaagtgttggttgctaaaataaaacttcataaaaatgagtgggtctattgtagcaaac |
34838040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 180 - 240
Target Start/End: Complemental strand, 31689237 - 31689177
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
31689237 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaa |
31689177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 168 - 232
Target Start/End: Complemental strand, 48314439 - 48314375
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctatt |
232 |
Q |
| |
|
|||| ||| |||||||||||||||| ||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
48314439 |
ttttagtctaaatgaaaaggtgttgcttgctaaaatagactttcatgaaaatgagtgggtctatt |
48314375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 269 - 307
Target Start/End: Complemental strand, 38961580 - 38961542
Alignment:
| Q |
269 |
ttttttgtcagtattagaagaaaaactcaaacttaaaga |
307 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38961580 |
ttttttgtcggtattagaagaaaaactcaaacttaaaga |
38961542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 97 - 143
Target Start/End: Complemental strand, 38961713 - 38961668
Alignment:
| Q |
97 |
gtaaatagtaaatgacaattacattttgtacccttcagtttcaattt |
143 |
Q |
| |
|
||||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
38961713 |
gtaaatagtaaatgacaattaca-tttgtatccttcagtttcaattt |
38961668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 12206824 - 12206763
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| || |||||| ||||||||||| |||||||| |
|
|
| T |
12206824 |
tgaaaaggtgcaggttgctaaaatagaccttcataaaaatgagtgggtctattgtagcaaac |
12206763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 12210926 - 12210987
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| || |||||||| |||||||| |
|
|
| T |
12210926 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagttggtctattgtagcaaac |
12210987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 34978404 - 34978352
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctatt |
232 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| || |||||| ||||||||||| |
|
|
| T |
34978404 |
tgaaaaggtgttggttgataaaatagaccttcataaaaatgagtgggtctatt |
34978352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 228
Target Start/End: Complemental strand, 42523276 - 42523214
Alignment:
| Q |
166 |
tcttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtc |
228 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||| ||| ||| || |||||| ||||||| |
|
|
| T |
42523276 |
tcttttggtccaaatgaaaaggtgttacttgctaaaagagaccttcataaaaatgagtgggtc |
42523214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 31135906 - 31135967
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||||||||||||||| | ||| |||||| || ||| |||||| |||||||| |
|
|
| T |
31135906 |
tgaaaaggtgttggttgctaaaatacaccttcatgaaattgaatggatctattgtagcaaac |
31135967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 39 - 72
Target Start/End: Complemental strand, 38961769 - 38961736
Alignment:
| Q |
39 |
gaaagaggaagagaatgaggaggaccattaatgt |
72 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
38961769 |
gaaagagaaagagaatgaggaggaccattaatgt |
38961736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 20628346 - 20628398
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctatt |
232 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||| || |||||| ||||||||||| |
|
|
| T |
20628346 |
tgaaaaggtgttgcttggtaaaatagaccttcataaaaatgggtgggtctatt |
20628398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 9)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 168 - 241
Target Start/End: Original strand, 17239402 - 17239475
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||| ||||||||||||| | ||||||||||||| ||| || |||||| ||||||||||| |||||||| |
|
|
| T |
17239402 |
ttttggtccaaatgaaaaggtgctacttgctaaaatagaccttcataaaaatgagtgggtctattgtagcaaac |
17239475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 42026956 - 42026895
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
42026956 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
42026895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 180 - 241
Target Start/End: Original strand, 42031701 - 42031762
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
42031701 |
tgaaaaggtgcaggttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
42031762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 241
Target Start/End: Complemental strand, 17238671 - 17238596
Alignment:
| Q |
166 |
tcttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||| ||| ||||||||| | ||||||||||||| ||| || |||||| ||||||||||| |||||||| |
|
|
| T |
17238671 |
tcttttggtccaaacgaaaaggtgctacttgctaaaatagaccttcataaaaatgagtgggtctattgtagcaaac |
17238596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 16802019 - 16801972
Alignment:
| Q |
194 |
ttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
16802019 |
ttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
16801972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 194 - 240
Target Start/End: Original strand, 16802704 - 16802750
Alignment:
| Q |
194 |
ttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
||||||||||||| |||||| |||||| ||||||||||| ||||||| |
|
|
| T |
16802704 |
ttgctaaaatagacctttataaaaatgagtgggtctattgtagcaaa |
16802750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 241
Target Start/End: Complemental strand, 34268036 - 34267975
Alignment:
| Q |
180 |
tgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| || ||| | ||||||||||| |||||||| |
|
|
| T |
34268036 |
tgaaaaggtgttgcttgctaaaatagaccttgataaaatggagtgggtctattgtagcaaac |
34267975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 34269089 - 34269153
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| || ||| | |||||||||| |||||||| |
|
|
| T |
34269089 |
aaatgaaaaggtgttgcttgctaaaatagaccttcataaaatggaatgggtctattgtagcaaac |
34269153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 241
Target Start/End: Original strand, 34275324 - 34275388
Alignment:
| Q |
177 |
aaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||| || ||| | |||||||||| |||||||| |
|
|
| T |
34275324 |
aaatgaaaaggtgttgcttgctaaaatagaccttcataaaatggaatgggtctattgtagcaaac |
34275388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 168 - 240
Target Start/End: Complemental strand, 24800 - 24728
Alignment:
| Q |
168 |
ttttggtcaaaatgaaaaggtgttggttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaa |
240 |
Q |
| |
|
|||| ||| |||||||||| | || ||| ||||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
24800 |
ttttagtctaaatgaaaagataatgcttgttaaaatagaacttcatgaaaatgagtgggtctattgtagcaaa |
24728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 194 - 241
Target Start/End: Complemental strand, 45379 - 45332
Alignment:
| Q |
194 |
ttgctaaaatagaactttatgaaaatgtgtgggtctattatagcaaac |
241 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||||||| |||||||| |
|
|
| T |
45379 |
ttgctaaaatagaccttcatgaaaatgagtgggtctattgtagcaaac |
45332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University