View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_107 (Length: 261)
Name: NF3820_high_107
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_107 |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0154 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 17 - 256
Target Start/End: Original strand, 5429 - 5679
Alignment:
| Q |
17 |
caatttatcccgaaaattttctactatgtattgtgtttggtttagtggaataagtagttccaccatgactttgtactttagctagagaacttgaagaaaa |
116 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
5429 |
caattgatcccgaaaattttctactatgtattgtgtttggtttagtggaataagtagttccaccatgactttgtactttagctagagtacttgaggaaaa |
5528 |
T |
 |
| Q |
117 |
acctaaagataaattcaaatttgtgggtgcgtt-----------attgttctgcatttctcaagtataaactttttgttagaccgttaagatgtctctga |
205 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5529 |
acctaaagataaattcaactttgtgggtgcgttattgttccctaattgttctgcatttctcaagtataaactttttgttagaccgttaagatgcctctga |
5628 |
T |
 |
| Q |
206 |
ggtaagcatcaagtatatatggaacataatttctcctcatttcatctcact |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5629 |
ggtaagcatcaagtatatatggaacataatttctcctcatttcatatcact |
5679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University