View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_108 (Length: 261)
Name: NF3820_high_108
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_108 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Complemental strand, 48399324 - 48399098
Alignment:
| Q |
17 |
aaatggtcctctccggttaaggatgtgctatcttgttgatcatgagattgtaagtggcatgtaaagggattggtgattggcgttccggtggctttttact |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399324 |
aaatggtcctctccggttaaggatgtgctatcttgttgatcctgagattgtaagtggcatgtaaagggattggtgattggcgttccggtggctttttact |
48399225 |
T |
|
| Q |
117 |
gtttgtcaccatatcatgtcttcgtgttgcatatatatagagattagagggaatgttaagagcaaagacaggctgatagtgttatttgttctttttgact |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48399224 |
gtttgtcaccatatcatgtcttcgtgttgcatatatatagagattaaagggaatgttaagagcaaagacaggctgatagtgttatttgttctttttgact |
48399125 |
T |
|
| Q |
217 |
aggtaatgatattagctgaagatgagc |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48399124 |
aggtaatgatattagctgaagatgagc |
48399098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 42 - 243
Target Start/End: Original strand, 47651956 - 47652153
Alignment:
| Q |
42 |
tgctatcttgttgatcatgagattgtaagtggcatgtaaagggattggtgattggcgttccggtggctttttactgtttgtcaccatatcatgtcttcgt |
141 |
Q |
| |
|
|||||||||| | ||| ||||||||| ||||||||||||||| || || ||||| | | |||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
47651956 |
tgctatcttgctaatcccgagattgtaggtggcatgtaaagggctttgtaattggtgctttggtggctttttattgtttgtcaccatagtctgtcttcgt |
47652055 |
T |
|
| Q |
142 |
gttgcatatatatagagattagagggaatgttaagagcaaagacaggctgatagtgttatttgttctttttgactaggtaatgatattagctgaagatga |
241 |
Q |
| |
|
||||||||| ||| |||||||| |||||| ||| |||||||||||||||||||||||||||||||| ||| ||||||||| ||| ||| ||||||| |
|
|
| T |
47652056 |
gttgcatat-tatc---attagaggaaatgttgagatcaaagacaggctgatagtgttatttgttctttgtgattaggtaatggtatcagccaaagatga |
47652151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University