View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_130 (Length: 249)
Name: NF3820_high_130
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_130 |
 |  |
|
| [»] scaffold0384 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 8723890 - 8724137
Alignment:
| Q |
1 |
gtcacctttgatgatccccaggtttgttttgctacattaaggttttaacttttaatgcttttaatatgtaacannnnnnnaaaatattctttaatcacta |
100 |
Q |
| |
|
|||||||| || ||| ||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
8723890 |
gtcaccttagaggattcccaggtttgttttgttacattaaggttttaacttttaatgcttttaatat-taacattttttttaaatattctttaatcacta |
8723988 |
T |
 |
| Q |
101 |
gaaatgaaatgagtat---------tgtgtttttc-ctttcaggatttgatatatttcttatctgataggttgttctgaaatttgaagatgtttggattc |
190 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
8723989 |
gaaatgaaatgagtatagtattgtatgtgtttttttctttcaggatttgatatatttcttatctgataggctgttctgaaatttgaagatgattggattc |
8724088 |
T |
 |
| Q |
191 |
attgtttgaaaatttgattttgaacccc-ttttctcttagtgtcatatt |
238 |
Q |
| |
|
||| |||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
8724089 |
attctttgaaaatttgattttgaacccctttttcttttagtgtcatatt |
8724137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 128 - 211
Target Start/End: Original strand, 8722621 - 8722702
Alignment:
| Q |
128 |
tttcaggatttgatatatttcttatctgataggttgttctgaaatttgaagatgtttggattcattgtttgaaaatttgatttt |
211 |
Q |
| |
|
|||||||||||||||| ||||| ||| || |||||||||||||| ||||||| ||||||| ||||||||||| ||||||||| |
|
|
| T |
8722621 |
tttcaggatttgatat-tttct-atccaattggttgttctgaaatatgaagattattggatttattgtttgaaattttgatttt |
8722702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 8 - 72
Target Start/End: Complemental strand, 7746 - 7682
Alignment:
| Q |
8 |
ttgatgatccccaggtttgttttgctacattaaggttttaacttttaatgcttttaatatgtaac |
72 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||| | ||||||| ||||||||| |||| |
|
|
| T |
7746 |
ttgatgatccctaggtttgttttgttacattaaggttttgatttttaattattttaatatataac |
7682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University