View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_146 (Length: 243)
Name: NF3820_high_146
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_146 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 17 - 225
Target Start/End: Complemental strand, 31027606 - 31027398
Alignment:
| Q |
17 |
gatgaatattggaagaagtggggattgtatattttcaactgtcctgaattgggggagaaggatcaatatagtagcatgactttattatggttgatacaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31027606 |
gatgaatattggaagaagtggggattgtatattttcaactgtcctgaattgggggagaaggatcaatatagtagcatgactttattatggttgatacaat |
31027507 |
T |
|
| Q |
117 |
ttgttcaggctaaccaagaatctcttgcctgctttcgtgggactattggtatcgttattcctggaagtgaaataccaagctggttgaacaaccagtgcgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31027506 |
ttgttcaggctaaccaagaatctcttgcctgctttcgtgggactattggtatcgttattcctggaagtgaaataccaagctggttgaacaaccagtgcgt |
31027407 |
T |
|
| Q |
217 |
aggtaaatc |
225 |
Q |
| |
|
||||||||| |
|
|
| T |
31027406 |
aggtaaatc |
31027398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 37 - 222
Target Start/End: Complemental strand, 31017550 - 31017362
Alignment:
| Q |
37 |
gggattgtatattttcaactgtcctgaattgggggagaaggatcaatatagtagcatgactttattatggttgatacaatttgttcaggctaaccaagaa |
136 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| || ||| | |||||| |||||||||| |||||||||||||||| |||| || ||||||||| |
|
|
| T |
31017550 |
gggattgtatatttttaactgtcctgaattgggggagaggggtcattgtagtagaatgactttatcatggttgatacaatttcttcatgccaaccaagaa |
31017451 |
T |
|
| Q |
137 |
tctcttgcctgctttcgtgggac---tattggtatcgttattcctggaagtgaaataccaagctggttgaacaaccagtgcgtaggtaa |
222 |
Q |
| |
|
|| |||| ||||||| || ||| ||||||||| |||||||||||||||||||||||||| ||||||||||| ||| || ||||||| |
|
|
| T |
31017450 |
tcctttgcttgctttcttgagactgatattggtattgttattcctggaagtgaaataccaaggtggttgaacaatcagagcctaggtaa |
31017362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 74
Target Start/End: Complemental strand, 31526381 - 31526345
Alignment:
| Q |
38 |
ggattgtatattttcaactgtcctgaattgggggaga |
74 |
Q |
| |
|
||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
31526381 |
ggattgtgtattttcaactgtcctgaattgggtgaga |
31526345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University