View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_55 (Length: 378)
Name: NF3820_high_55
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_55 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 52 - 359
Target Start/End: Complemental strand, 8951705 - 8951403
Alignment:
| Q |
52 |
acatagaccattaagagccaagttgcggcggtgaaacaataacatggtggggacaaaattattgcaagaaacccaaataaggaacttgatcttttttgaa |
151 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |
|
|
| T |
8951705 |
acatagaccattaagagccaag-----gcggcgaaacaataacatggtggggacaaaattattgcaagaaaatcaaataaggaacttgatcttttttgga |
8951611 |
T |
|
| Q |
152 |
agatggaggcgtcatattaaagaccatgttaaaggagttacacatgcacttctatgcttcaaaatccataagaaaccaaccctggtagtttagcaaccat |
251 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8951610 |
agatggaggcttcatattaaagaccatgttagaggagttacacatgcacttctatgcttcaaaatccataagaaaccaaccctggtagtttagcaaccat |
8951511 |
T |
|
| Q |
252 |
ttgtgtgtttcagaccatatgaaagtatatatcttcagtgtcggggttaaagtggagattaggattgttgatttcatcaatgaggccttaaggtaattga |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | ||| |||||||||| |
|
|
| T |
8951510 |
ttgtgtgtttcagaccatatgaaagtatatatcttcagtgtcggggttaaagtggagattaggattgttgatttgatcaatgatgtcttgaggtaattga |
8951411 |
T |
|
| Q |
352 |
gtatagag |
359 |
Q |
| |
|
|| ||||| |
|
|
| T |
8951410 |
gtgtagag |
8951403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 17 - 57
Target Start/End: Complemental strand, 8953826 - 8953786
Alignment:
| Q |
17 |
taaaggaatgactcattatgcttattacatcggggacatag |
57 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
8953826 |
taaatgaatgactcattatgtttattacatcggggacatag |
8953786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University