View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_94 (Length: 294)
Name: NF3820_high_94
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_94 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 5e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 159 - 278
Target Start/End: Complemental strand, 40948487 - 40948368
Alignment:
| Q |
159 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40948487 |
atacatacataataatgatttatcaaaatgactctaaaatcaacattaagctaaaagaacttcaaaaactacatacaatcgtagactagttaagtagtac |
40948388 |
T |
 |
| Q |
259 |
taaacattgatacacaatat |
278 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
40948387 |
taaacattgatacacaatat |
40948368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 11 - 143
Target Start/End: Complemental strand, 40945626 - 40945494
Alignment:
| Q |
11 |
gaagaagaagaaaacaaatcacttatcgttgtttggctaacacctgaacaaatggctcaaagacaagatactgagctgaaacatattgtttttgggatag |
110 |
Q |
| |
|
|||||| ||||||| ||||||| ||| |||||| || ||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40945626 |
gaagaacaagaaaataaatcacctattgttgttcggttaacaccggaacaaatggctcaaagacaagatactgagctgaaacacattgtttttgggatag |
40945527 |
T |
 |
| Q |
111 |
ctgcttcatcggatttatggaatacaagaaaag |
143 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |
|
|
| T |
40945526 |
ctgcttcatcaaatttatggaatacaagaaaag |
40945494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 66 - 141
Target Start/End: Complemental strand, 22776957 - 22776882
Alignment:
| Q |
66 |
ctcaaagacaagatactgagctgaaacatattgtttttgggatagctgcttcatcggatttatggaatacaagaaa |
141 |
Q |
| |
|
||||||||||||| || ||| | ||||| ||||||||||||||||| |||||||| |||| ||||| | |||||| |
|
|
| T |
22776957 |
ctcaaagacaagacacagagatcaaacacattgtttttgggatagcggcttcatcaaatttgtggaacataagaaa |
22776882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University