View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_high_99 (Length: 276)
Name: NF3820_high_99
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_high_99 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 38 - 266
Target Start/End: Original strand, 11985028 - 11985256
Alignment:
| Q |
38 |
cttctataaaattacagtagatcatcatgattctgatataccgattatgataccaaacatatcgaataaagtttgtaaggcaatcacaattgtcaccacg |
137 |
Q |
| |
|
||||| |||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11985028 |
cttctgtaaaatcacagtagatcatcataattctaatataccgattatgataccaaacatatcgaataaagtttgcaaggcaatcacaattgtcaccacg |
11985127 |
T |
 |
| Q |
138 |
acccgaataaaatacttaagcaaaataaagtttgttggtttagttagttacctttctgcaattgatcccatctttagttgaaagttgaatagagagagaa |
237 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11985128 |
accagaataaaatacttaagcaaaataaagtttgttggtttagttagttacctttctgcaattgatcccatctttagttgaaagttgaatagagagagaa |
11985227 |
T |
 |
| Q |
238 |
taatgcttcacttcagctatagttctgtg |
266 |
Q |
| |
|
|||||||||||||||||||||| |||||| |
|
|
| T |
11985228 |
taatgcttcacttcagctatagctctgtg |
11985256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University