View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_101 (Length: 292)
Name: NF3820_low_101
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_101 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 19 - 288
Target Start/End: Original strand, 33535656 - 33535926
Alignment:
| Q |
19 |
gtttggcatgaagaccccacttaaaataggaagagaccctttagttttgcttgttaccttcctctctattccatattggaggttggtgtgagtgggg-at |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33535656 |
gtttggcatgaagaccccacttaaaatagggagagaccctttagttttgcttgttaccttcctctctattccatattggaggttggtgtgagtgggggat |
33535755 |
T |
 |
| Q |
118 |
tcttcctattgatgattttgtgggactgaggcaaagcatggatgatttggttctttttcattaggtaaatataaattattggaccatacaattagagaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33535756 |
tcttcctattgatgattttgtgggactgaggcaaaacatggatgatttggttctttttcattaggtaaatataaattattgggccatacaattagagaca |
33535855 |
T |
 |
| Q |
218 |
ttgttgagatctcatgagaggcaattggtcaagtttatacacattttgtgtctcctactgttcgtctgtgc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33535856 |
ttgttgagatctcatgagaggcaattggtcaagtttatacacattttgtgtctcctactgttcgtcggtgc |
33535926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University