View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_141 (Length: 248)
Name: NF3820_low_141
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_141 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 12 - 248
Target Start/End: Complemental strand, 6188720 - 6188484
Alignment:
| Q |
12 |
gaagacaattgttgaagttaagaaaaagaaagcataatggaaaatgttgttggatgttttacgaatttgatgtatcagtcgattcaacaggttggaatgg |
111 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
6188720 |
gaagacaatcgttgaagttaagaaaaagaaagtataatggaaaatgttgttggatgttttacgaatttaatgtatcagttgattcaacaggttggaatgg |
6188621 |
T |
 |
| Q |
112 |
aatttgacaagatctttcgtttatttgatctcgtttgagtcgtagtttcgttaaataagttgaataaatgttaaattgggttgaactattgaaaatatgt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6188620 |
aatttgacaagatctttcgtttatttgatctcgtttgagtcgtagtttcgttaaataagttgaataaatgttgaattgggttgaactattgaaaatatgt |
6188521 |
T |
 |
| Q |
212 |
atgaaatattcgaacttgcatcctttactactctagt |
248 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6188520 |
atgaaatattcgaacttgcattctttactactctagt |
6188484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University