View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_154 (Length: 243)
Name: NF3820_low_154
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_154 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 20 - 229
Target Start/End: Original strand, 33675599 - 33675808
Alignment:
| Q |
20 |
aaaagctccctctgaagtcaactcttttatttgatctgtggtacttaataaaattaatagtataataataatattgtaggttcgtaggatgcataaggct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675599 |
aaaagctccctctgaagtcaactcttttatttgatctgtggtacttaataaaattaatagtataataataatattgtaggttcgtaggatgcataaggct |
33675698 |
T |
 |
| Q |
120 |
tgttccactgatatatgtgtaatgtgtcaagtttggtggttgctcagaaccagtgtcacctcctattcatacattctgctgctgtttctttatggaattt |
219 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33675699 |
tgttccactgatatatgtctaatgtgtcaagtgtggtggttgctcagaaccagtgtcacctcctattcatacattctgctgctgtttctttatggaattt |
33675798 |
T |
 |
| Q |
220 |
tgagaataat |
229 |
Q |
| |
|
|||| ||||| |
|
|
| T |
33675799 |
tgaggataat |
33675808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University