View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_161 (Length: 237)
Name: NF3820_low_161
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_161 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 125 - 221
Target Start/End: Original strand, 21259933 - 21260029
Alignment:
| Q |
125 |
gataatcacatttgtttttactagagttggtatcatgatgtgttagtaactcttaattgtatatgtggcagcatgcatgatgagagggcaaggacag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21259933 |
gataatcacatttgtttttactagagttggtatcatgatgtgttagtaactcttaattgtatatgtggcagcatgcatgatgagaaggcaaggacag |
21260029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 21259627 - 21259729
Alignment:
| Q |
1 |
agcatgcaacacatgataacaattcaac-actctttgcaatatgtttgtcttaaaagaagataagaacacattaaatgtatatgcaaacaattaataaat |
99 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21259627 |
agcatgcaacacatgataacaattcaaatactctttgcaatatgtttgtcttaaa-gaagataagaacacattaaatgtatatgcaaacaattaataaat |
21259725 |
T |
|
| Q |
100 |
ataa |
103 |
Q |
| |
|
|||| |
|
|
| T |
21259726 |
ataa |
21259729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University