View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_163 (Length: 236)
Name: NF3820_low_163
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_163 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 55 - 220
Target Start/End: Original strand, 27539325 - 27539490
Alignment:
| Q |
55 |
taacttatttataaattctcacatttgtgaggtggtgggaccaatatatgtctggtttctttcttattttaatcgctggac---catgccaccgaagaga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| || |||| |||||||||||||||| |
|
|
| T |
27539325 |
taacttatttataaattctcacatttgttaggtggtgggaccaatatatgactggtttctttcttattttaattgcgggaccaacatgccaccgaagaga |
27539424 |
T |
 |
| Q |
152 |
gatatggtccctgtataggtgatggtgactaataggtatcagtttttcccttctctaacgagggtttta |
220 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27539425 |
tatatggtccctgtataggtgatggt---aaataggtatcattttttcccttctctaacgagggtttta |
27539490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 27538853 - 27538913
Alignment:
| Q |
1 |
atctctcgtaccatatagcaagactcaccactaaatgagcctcgggtgtacatataactta |
61 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
27538853 |
atctctcgtaccatatggcaagactcaccgctaaatgggcctcgggtgtacatataactta |
27538913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University