View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_169 (Length: 231)
Name: NF3820_low_169
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_169 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 44567809 - 44568016
Alignment:
| Q |
8 |
cgaagaaaatatgaagaggtatgcctctatgttttgtcacgttcctttactattgtgattctaatgcttgattttgatgttgtctaattctgtgattgaa |
107 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567809 |
cgaagcaaatatgaagaggtatgcctctatgttttgtcacgttcctttactattgtgattctaatgcttgattttgatgttgtctaattctgtgattgaa |
44567908 |
T |
 |
| Q |
108 |
atttgttaatttactataacactccttagttccattctcaactagaaatatatgtgttgtaggttgatgtcagttttgttttatttttcctttctaaaaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44567909 |
atttgttaatttactataacactccttagttccattctcaactagaaatatatgtgttgtaggttgatgtcagttttgttttatttttcctttctaaaaa |
44568008 |
T |
 |
| Q |
208 |
acacttgt |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
44568009 |
acacttgt |
44568016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 114
Target Start/End: Complemental strand, 36028968 - 36028897
Alignment:
| Q |
42 |
tgtcacgttcctttactattgtgattctaatgcttgattttgatgttgtctaattctgtgattgaaatttgtt |
114 |
Q |
| |
|
||||| ||||||||||||||| || | | |||||||||||||||| | | ||||||| |||||||||||||| |
|
|
| T |
36028968 |
tgtcatgttcctttactattgcgaatattatgcttgattttgatggtat-aaattctgcgattgaaatttgtt |
36028897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University