View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_178 (Length: 213)
Name: NF3820_low_178
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_178 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 42467088 - 42467276
Alignment:
| Q |
18 |
caattggggtgcttcttaccaagcatttgcaacacttagtggccaaactctttctttcaagattacttcttacacaaccaaagaaactataatagcttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42467088 |
caattggggtgcttcttaccaagcatttgcaacacttagtggccaaactctttctttcaagattacttcttacacaaccaaagaaactataatagcttgg |
42467187 |
T |
|
| Q |
118 |
aatgttgctccttccaactggggtgctggaataacctattccacacatgtcaattttcattgaagtatgttgccatctgtgctcctcct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
42467188 |
aatgttgctccttccaactggggtgctggactaacctattccacacatgtcaattttcattgaagtatgttgccatcagtgctcatcct |
42467276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 22 - 134
Target Start/End: Complemental strand, 3183623 - 3183511
Alignment:
| Q |
22 |
tggggtgcttcttaccaagcatttgcaacacttagtggccaaactctttctttcaagattacttcttacacaaccaaagaaactataatagcttggaatg |
121 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||| ||| |||||||||||| | ||||||| ||||| || || || ||||| || || ||||||| |
|
|
| T |
3183623 |
tggggtgcttcctaccaagcatttgcaacactaggtggtcaagctctttctttcaggcttacttcatacaccactaaggagactattattgcatggaatg |
3183524 |
T |
|
| Q |
122 |
ttgctccttccaa |
134 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3183523 |
ttgctccttccaa |
3183511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University