View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_184 (Length: 207)
Name: NF3820_low_184
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_184 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 19 - 189
Target Start/End: Original strand, 44135865 - 44136036
Alignment:
| Q |
19 |
actagaaacatgatactttgttaaattagttaaacgatgaaccgataaaa-aacatagtcattgactcattgatagttatctcacaatcactagcgaacg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44135865 |
actagaaacatgatactttgttaaattagttaaacgatgacatgataaaaaaacatagtcattgactcattgatagttatctaacaatcactagcgaacg |
44135964 |
T |
 |
| Q |
118 |
agaattaagactcaattgatatattttttacatttatgtgaaaaattgaaggtgcatagagagcaactctcc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44135965 |
agaattaagactcaattgatatatttttgacatttatgtgaaaaattgaaggtgcatagagagcaactctcc |
44136036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University