View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3820_low_185 (Length: 205)

Name: NF3820_low_185
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3820_low_185
NF3820_low_185
[»] chr6 (3 HSPs)
chr6 (15-119)||(16839487-16839591)
chr6 (25-119)||(16798184-16798278)
chr6 (15-119)||(17070511-17070615)


Alignment Details
Target: chr6 (Bit Score: 82; Significance: 6e-39; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 15 - 119
Target Start/End: Original strand, 16839487 - 16839591
Alignment:
15 atgaaacaaggtttgctataggaaattgaatatgataaattgtttgtttttgatgattaaatcggtggctatagtttgcct-ttatagacaacaataatt 113  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||    
16839487 atgaatcaaagtttgctataggaaattgaatatgataaattgtttgtttttgatgattaaatcggtggctatag-ttgcctcttatagacaacaataatt 16839585  T
114 agtatt 119  Q
    ||||||    
16839586 agtatt 16839591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 25 - 119
Target Start/End: Original strand, 16798184 - 16798278
Alignment:
25 gtttgctataggaaattgaatatgataaattgtttgtttttgatgattaaatcggtggctatagtttgcct-ttatagacaacaataattagtatt 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| ||||||||||||||||||||||||    
16798184 gtttgctataggaaattgaatatgataaattgtttgtttttgatgattaaatcggtggttatag-ttgcctcttatagacaacaataattagtatt 16798278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 15 - 119
Target Start/End: Original strand, 17070511 - 17070615
Alignment:
15 atgaaacaaggtttgctataggaaattgaatatgataaattgtttgtttttgatgattaaatcggtggctatagtttgcct-ttatagacaacaataatt 113  Q
    ||||| ||| ||||||| |||||| ||||||||| |||||||||||||||||||||||||||||| ||||| || |||| | ||||||||||||||||||    
17070511 atgaatcaaagtttgctgtaggaagttgaatatggtaaattgtttgtttttgatgattaaatcgggggctaaag-ttgcttcttatagacaacaataatt 17070609  T
114 agtatt 119  Q
    ||||||    
17070610 agtatt 17070615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University