View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_186 (Length: 202)
Name: NF3820_low_186
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_186 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 8757591 - 8757473
Alignment:
| Q |
18 |
atcttttcactcctcaatggattagtgtagatggatttgtaaaacaatcaccatccagacttgtaaatccatattttcctaactaggtcttagatttgta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8757591 |
atcttttcactcctcaatggattagtgtagatgggtttgtaaaacaatcaccatccagacttgtaaatccatattttcctaactaggtcttagattcgta |
8757492 |
T |
 |
| Q |
118 |
actatgctacataacataa |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8757491 |
actatgctacataacataa |
8757473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University