View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3820_low_71 (Length: 362)

Name: NF3820_low_71
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3820_low_71
NF3820_low_71
[»] chr3 (1 HSPs)
chr3 (177-346)||(32731890-32732072)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 177 - 346
Target Start/End: Complemental strand, 32732072 - 32731890
Alignment:
177 gtttctacaattcaaacctcaaattcaccnnnnnnncaaagagattcaaactcaaactt-------------atttttactttaattgatatacttccaa 263  Q
    |||||||||||||||||||||||||||||       |||||||||||||||||||||||             ||||||||||||||||||||||||||||    
32732072 gtttctacaattcaaacctcaaattcaccaaaaaaacaaagagattcaaactcaaactttttatttatatgtatttttactttaattgatatacttccaa 32731973  T
264 atatgtaaatataagagggttaccaaatgcaatcaataatcgacttttattaaaaagtataaaatggatttttgtagcaaatg 346  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32731972 atatgtaaatataagagggttaccaaatgcaatcaataatcgacttttattaaaaagtataaaatggatttttgtagcaaatg 32731890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University