View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_71 (Length: 362)
Name: NF3820_low_71
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_71 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 118; Significance: 4e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 177 - 346
Target Start/End: Complemental strand, 32732072 - 32731890
Alignment:
| Q |
177 |
gtttctacaattcaaacctcaaattcaccnnnnnnncaaagagattcaaactcaaactt-------------atttttactttaattgatatacttccaa |
263 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32732072 |
gtttctacaattcaaacctcaaattcaccaaaaaaacaaagagattcaaactcaaactttttatttatatgtatttttactttaattgatatacttccaa |
32731973 |
T |
 |
| Q |
264 |
atatgtaaatataagagggttaccaaatgcaatcaataatcgacttttattaaaaagtataaaatggatttttgtagcaaatg |
346 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32731972 |
atatgtaaatataagagggttaccaaatgcaatcaataatcgacttttattaaaaagtataaaatggatttttgtagcaaatg |
32731890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University