View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_73 (Length: 358)
Name: NF3820_low_73
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_73 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 333; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 333; E-Value: 0
Query Start/End: Original strand, 1 - 341
Target Start/End: Original strand, 6247085 - 6247425
Alignment:
| Q |
1 |
actttcttgccttatagacaagggattttgggaaggttgtctggatttggactatagatgcaatttctcaagtttttattcagttgttctttaattttct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6247085 |
actttcttgccttatagacaagggattttgggaaggttgtctggatttggactatagatgcaatttctcaagtttttattcggttgttctttaattttct |
6247184 |
T |
|
| Q |
101 |
ccaacttttgttgttgttaaaaagttgtattcatttgttaaattttgtaatatgaacctatcaacaaaggtttaatcaagttgtgtaaacagaatttgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6247185 |
ccaacttttgttgttgttaaaaagttgtattcatttgttaaattttgtaatatgaacctatcaacaaaggtttaatcaagttgtgtaaacagaatttgta |
6247284 |
T |
|
| Q |
201 |
atatgatactatcatacatatataatgtatattaattgtaattatacatatgagattatgagtatatgatgtcccaacactctttatagtttatatatgt |
300 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6247285 |
atatgatactattatacatatataatgtatattaattgtaattatacatatgagattatgagtatatgatgtcccaacactctttatagtttatatatgt |
6247384 |
T |
|
| Q |
301 |
gctaatcaaaattctttagcacaaagtctaattagtttatg |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6247385 |
gctaatcaaaattctttagcacaaagtctaattagtttatg |
6247425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 46630033 - 46629996
Alignment:
| Q |
1 |
actttcttgccttatagacaagggattttgggaaggtt |
38 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
46630033 |
actttcttgccttataaacaagggattttgggtaggtt |
46629996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University