View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3820_low_99 (Length: 298)
Name: NF3820_low_99
Description: NF3820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3820_low_99 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 80 - 239
Target Start/End: Original strand, 44144042 - 44144203
Alignment:
| Q |
80 |
gattatgttttttctcttcttcagtgtgtgaaggtcgacagcggcgaaagggatgacggaggtgttgcaaggtagcagcaatggggcgactgaatggtgt |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44144042 |
gattatgttttttctcttcttcagtgtgtgaaggtcgacagcggcgaaagggatgacggaggtgttgcaaggtagcagcaatggggcgactgaatggtgt |
44144141 |
T |
 |
| Q |
180 |
tttgta-tgtgat-gaaaatgaaatttcaaaataggacattaatcactcaaaataatctcta |
239 |
Q |
| |
|
|||||| |||||| || |||| |||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
44144142 |
tttgtattgtgatagacaatggaatttcaaaataggacataagtcactcaaaataatctcta |
44144203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 44143603 - 44143678
Alignment:
| Q |
1 |
tatagaaaaagactctcaaattaagtatat--gtctgta-tgtaactagtttaatttggctgctgtaacaaagtga |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| | || |||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
44143603 |
tatagaaaaagactctcaaattaagtatgtctgtatgtaatgtaactagtttaatttggctgttgtaacaaagtga |
44143678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 231 - 296
Target Start/End: Original strand, 44146634 - 44146702
Alignment:
| Q |
231 |
taatctctaatgctaaaataaattaccatcac--ttctt-aaaagtgtttcaattacattctcattctc |
296 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||| |||||||||||||||||| |||||||||| |
|
|
| T |
44146634 |
taatctctaatgctaaaataaattacactctctattcttaaaaagtgtttcaattacactctcattctc |
44146702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University