View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3822_low_13 (Length: 251)
Name: NF3822_low_13
Description: NF3822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3822_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 212
Target Start/End: Complemental strand, 2992515 - 2992304
Alignment:
| Q |
1 |
aacatttaacttttgattttcatcactagtggaaannnnnnnggcagtgcttgaactttgttacctagctattgcttgttttgggttataggtcacgttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2992515 |
aacatttaacttttgattttcatcactagtggataaatttttggcggtgcttgaactttgttacctagctattgcttgttttgggttataggtcacgttt |
2992416 |
T |
|
| Q |
101 |
tgttgttcttttcgtgcttgtgcctaatttgtaacataacttgatattcttttgaaccctatccttacactacttatgcaattggttctgtttttggtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2992415 |
tgttgttcttttcgtgcttgtgcctaatttgtaacataacttgatattcttttgaaccctatccttacactacttatgcaattggttctgtttttggtgc |
2992316 |
T |
|
| Q |
201 |
tgcactcttcga |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2992315 |
tgcactcttcga |
2992304 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University