View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3823_high_20 (Length: 234)

Name: NF3823_high_20
Description: NF3823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3823_high_20
NF3823_high_20
[»] chr4 (1 HSPs)
chr4 (8-222)||(33758549-33758765)


Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 33758765 - 33758549
Alignment:
8 atcaaatggatggactttaggattcctgatatttagtcatatcaaatgagagagttcttgaacggtctctttcagagtccctgtaacccaacctaatgtt 107  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33758765 atcaaatggatggattttaggattcctgatatttagtcatatcaaatgagagagttcttgaacggtctctttcagagtccctgtaacccaacctaatgtt 33758666  T
108 ttagctttgtcttttgttgtcaaaataatacaacataaatcttctttattgagatgtttgaacataacttcaaattgcaaccctcgcattataact--at 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||    
33758665 ttagctttgtcttttgttgtcaaaataatacaacataaatcttctttattgagatgtttgaacataacttcaaattgcaaccctcgcattataactacat 33758566  T
206 attgcaacacccacagg 222  Q
    |||||||||||||||||    
33758565 attgcaacacccacagg 33758549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University