View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3823_low_15 (Length: 289)
Name: NF3823_low_15
Description: NF3823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3823_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 99 - 272
Target Start/End: Complemental strand, 19419801 - 19419628
Alignment:
| Q |
99 |
gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19419801 |
gatgccgccgaaatcctcaccaccgccggtcacgaagccatggcactcaacctcgaactcgcttcccattctctcatcgctcgccgtcaatctcgctccc |
19419702 |
T |
|
| Q |
199 |
taaccatcttcgctcccacgaacttcgctttcagccagattcctcagattcctctctctctcctccgttaccaa |
272 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
19419701 |
taaccatcttcgctccgacgaacttcgctttcagccagattcctcagcttcctctctctctcctccgttaccaa |
19419628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University