View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3823_low_20 (Length: 234)
Name: NF3823_low_20
Description: NF3823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3823_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 33758765 - 33758549
Alignment:
| Q |
8 |
atcaaatggatggactttaggattcctgatatttagtcatatcaaatgagagagttcttgaacggtctctttcagagtccctgtaacccaacctaatgtt |
107 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33758765 |
atcaaatggatggattttaggattcctgatatttagtcatatcaaatgagagagttcttgaacggtctctttcagagtccctgtaacccaacctaatgtt |
33758666 |
T |
 |
| Q |
108 |
ttagctttgtcttttgttgtcaaaataatacaacataaatcttctttattgagatgtttgaacataacttcaaattgcaaccctcgcattataact--at |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
33758665 |
ttagctttgtcttttgttgtcaaaataatacaacataaatcttctttattgagatgtttgaacataacttcaaattgcaaccctcgcattataactacat |
33758566 |
T |
 |
| Q |
206 |
attgcaacacccacagg |
222 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
33758565 |
attgcaacacccacagg |
33758549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University