View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3824_low_1 (Length: 349)
Name: NF3824_low_1
Description: NF3824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3824_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-106; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 109 - 340
Target Start/End: Original strand, 38311328 - 38311557
Alignment:
| Q |
109 |
tatatacttcaacattatctcattcccgctgccaaaaccagtactatatatttacgtgtgtttttgatggatgatggatgacgctgtcacttctctaaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38311328 |
tatatacttcaacattatctcattcccgctgccaaaaccagttctatatatttacgtgt--ttttgatggatgatggatgacgctgtcacttctctaaat |
38311425 |
T |
|
| Q |
209 |
taacattcnnnnnnncaacccgacacaaagcgctagctcacaccaaatgacatgtaaccaatcaattttctgcgacctgaaccagttccaagcagcggca |
308 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38311426 |
taacattcaaaaaaacaacccgacacaaagcgctagctcacaccaaatgacatgtaaccaatcaattttctgcgacctgaaccagttccaagcagcggca |
38311525 |
T |
|
| Q |
309 |
cccctctgccgtagggtcctcaagttcctatg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38311526 |
cccctctgccgtagggtcctcaagttcctatg |
38311557 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 114 - 160
Target Start/End: Original strand, 38267549 - 38267595
Alignment:
| Q |
114 |
acttcaacattatctcattcccgctgccaaaaccagtactatatatt |
160 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
38267549 |
acttcaacatcatctcattccttctgccaaaaccagtactatatatt |
38267595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 52 - 83
Target Start/End: Original strand, 38311299 - 38311330
Alignment:
| Q |
52 |
gaacatcgttacccaaatggttagttttttat |
83 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38311299 |
gaacatcgttacccaaatggttagttttttat |
38311330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University