View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3824_low_3 (Length: 315)
Name: NF3824_low_3
Description: NF3824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3824_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 5e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 12 - 197
Target Start/End: Complemental strand, 41628762 - 41628577
Alignment:
| Q |
12 |
acagattcgtagtgcagaattgaggtgtacatcgtaagttctgacttgtttctgcagagcaaaacatggtacctctcaacgaaggtatgcttatctatca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41628762 |
acagattcgtagtgcagaattgaggtgtacattgtaagttctgacttgtttctgcagagcaaaacatggtacctctcaacgaaggtatgcttatctatca |
41628663 |
T |
 |
| Q |
112 |
agtaacttttaagaaaaatactgtcttttacttccaagtcttctaaccatataactgctgttattttctttgatgtattactgcca |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41628662 |
agtaacttttaagaaaaatactgttttttacttccaagtcttctaaccatataactgctgttattttctttgatgtattactgcca |
41628577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 246 - 297
Target Start/End: Complemental strand, 41628528 - 41628477
Alignment:
| Q |
246 |
catgattagtagaaaatttgtgtttcataaaaaccagattgtcatgctatat |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
41628528 |
catgattagtagaaaatttgtgtttcataaaaacaagattgtcatgctatat |
41628477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University