View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3824_low_5 (Length: 248)
Name: NF3824_low_5
Description: NF3824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3824_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 237
Target Start/End: Complemental strand, 40549182 - 40548950
Alignment:
| Q |
19 |
gttatgatggtgaataggtgtaaaacgattcatgaggcatactgaaaaggaagaagaaggatggtgctgctgagtaggatgactttaagctttggaccaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
40549182 |
gttatgatggtgaataggtgtaaaacgattcatgaggcatactgaaaaggaagaagaaggatggtgctgctgagcaggatgactttaagctttggaccaa |
40549083 |
T |
|
| Q |
119 |
agattgaattcgttata--------------aacgagcttattatttagtatttgattagaaattaatgctaattgggtttatgttcatctctaatgtat |
204 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40549082 |
agattgaattcgttttagtttttggtcttgggacgagcttattatttagtatttgattagaaattaatgctaattgggtttatgttcatctctaatgtat |
40548983 |
T |
|
| Q |
205 |
ggctttagccacagtttcaaattgttttttcat |
237 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
40548982 |
ggctttagccacagtttcaaattgttgtttcat |
40548950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University