View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_high_15 (Length: 380)
Name: NF3825_high_15
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_high_15 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 147 - 380
Target Start/End: Complemental strand, 38385188 - 38384955
Alignment:
| Q |
147 |
tttcaggtttggggcaactatcaactccatatgctgttgaaaaaggagggtgggcatctaccttattgctagtaggacttggggtaatctgtgcttatac |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38385188 |
tttcaggtttggggcaactatcaactccatatgctgttgaaaaaggagggtgggcatctaccttattgctagtaggacttggggtaatctgtgcttatac |
38385089 |
T |
 |
| Q |
247 |
ctcacatatacttggaaaatgtcttgaaaagaatccaaagttaacaagttatgtggatattgggattcaagcatttggatcaaagggaagattcttagtt |
346 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38385088 |
ctctcatatacttggaaaatgtcttgaaaagaatccaaagttaacaagttatgtggatattgggaatcaagcatttggatcaaagggaagattcttagtt |
38384989 |
T |
 |
| Q |
347 |
gcaacattcatctacatggaaatcttcatatcac |
380 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
38384988 |
gcaacattcatctacatggaaatcttcatgtcac |
38384955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 83
Target Start/End: Complemental strand, 38385334 - 38385252
Alignment:
| Q |
1 |
aaagaataccgataaactttatcccttgttttaattaggattaagtaatcataatctaaagtggcttgttcaagtaataatta |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38385334 |
aaagaataccgataaactttatcccttgttttaattaggattaagtaatcataatctaaagtggcttgttcaagtaataatta |
38385252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University