View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_high_21 (Length: 312)
Name: NF3825_high_21
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 49698375 - 49698673
Alignment:
| Q |
1 |
attatcaattaaaccatcattacaaatcactcaacgattaattttgtggagcttcattgattaatgtcaaggagaagaagcaattaacaccatacaatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49698375 |
attatcaattaaaccatcattacaaatcactcaacgattaattttgtggaacttcattgattaatgtcaaggagaagaagcaattaacaccatacaatac |
49698474 |
T |
 |
| Q |
101 |
cacacaaattccatctccagagaattaataaagaagctagtgttgcatggtgattaatcatataatgattgaacaaagttagctagcttcataaaaaccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49698475 |
cacacaaattccatctccagagaattaataaagaagctggtgttgcatggtgattaatcatataatgattgaacaaagttagctagcttcataaaaaccg |
49698574 |
T |
 |
| Q |
201 |
tagacgtacaatcgtgacattaagaaatttcattgaaacattgttactaatctctacggtgtgcaaaaatgatgtatgaaagccacaacgatgatgatg |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49698575 |
tagacgtacaatcgtgacattaagaaatttcattgaaacattgttactaatctctacggtgtgcaaaaatgatgtatgaaagccacaacgatgatgatg |
49698673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University