View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_high_47 (Length: 229)
Name: NF3825_high_47
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_high_47 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 44534490 - 44534354
Alignment:
| Q |
1 |
gaacatacataatgatgctttttcaaatgggaccatgatttnnnnnnnnnnnnntaaattgaatttttatggtccaggtgtttgtggtatgcctttaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44534490 |
gaacatacataatgatgctttttcaaatgggaccatgatttaaaaagaaaaaaataaattgaatttttatggtccaggtgtttgtggtatgcctttaata |
44534391 |
T |
|
| Q |
101 |
tatgactattttcagtgacaaagttcaataacatctt |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44534390 |
tatgactattttcagtgacaaagttcaataacatctt |
44534354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University