View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_high_53 (Length: 204)
Name: NF3825_high_53
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_high_53 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 15097034 - 15096844
Alignment:
| Q |
17 |
caatttggagtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggttgtattgatggcggggtatgtcggcttgtttaggaagaaggaga |
116 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15097034 |
caatttggtgtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggtcgtgttgatggcggggtatgtcgggttgtttaggaagaaggaga |
15096935 |
T |
 |
| Q |
117 |
tgatgttaaagtggcccggct---gcggcggtggcggagggatgatggttgtgagtgaaggtttgggggagttgatgaaattggctgtacc |
204 |
Q |
| |
|
|||||||||| ||||| || | ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15096934 |
tgatgttaaaatggccgggttgtggcggcggtggcggagggatgatggtggttagtgaaggtttgggggagttgatgaaattggctgtacc |
15096844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University