View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_35 (Length: 256)
Name: NF3825_low_35
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_35 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 76 - 238
Target Start/End: Complemental strand, 33615144 - 33614982
Alignment:
| Q |
76 |
ctcaaagtttatgagttgtatatgtggccagtaaccacgtctttcacaaattttctgttcttttcacccaaagacaaaatatgtccnnnnnnnggacaaa |
175 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
33615144 |
ctcaaagtttttgagttgtatatgtggccagtaaccacgtctttcacaaattttctgttcttttcacccaaagacaaaatatgtcctttttttggacaaa |
33615045 |
T |
 |
| Q |
176 |
atatccctgcattcttgtgacaattctaaacacaaatagctgttcaaacctctacaataggta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33615044 |
atatccctgcattcttgtgacaattctaaacacaaatagctgttcaaacctctacaataggta |
33614982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University