View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_37 (Length: 250)
Name: NF3825_low_37
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 35318650 - 35318408
Alignment:
| Q |
1 |
agaagtatagcaccatctaaggtgcaaacccttaccaactcgagggaatctatagcaaagagggtgagtatttgtgatgggagggtcgtagattgtgtgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35318650 |
agaagtatagcaccatctaaggtgcaaacccttaccaactcgagggaatctatagcaaagagggtgagtatttgtgatggtagggtcgtagattgtgtgt |
35318551 |
T |
|
| Q |
101 |
ggtgtccagagattttggaggtggaggaccatttgttttgtatttataaatttttcggcttggtgtgataccttattttcaaatggatgggaaggggtgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
35318550 |
ggtgtccagagattttggaggtggaggaccatttgttttgtatttataaattttccggcttgatgtgataccttattttcaaatggatggg-aggggtgt |
35318452 |
T |
|
| Q |
201 |
gattttcccgggactattacctctcttttggacacctttgcttc |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35318451 |
gattttcccgggactattacctctcttttggacacctttgcttc |
35318408 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University