View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_42 (Length: 242)
Name: NF3825_low_42
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 22 - 227
Target Start/End: Original strand, 10275580 - 10275782
Alignment:
| Q |
22 |
atagacattgtattgcaatgtcatctatgtgaccaatcgtgttattattgtcatcaatatggttgatatgagttggtttgaaatttgaaggataaggttn |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10275580 |
atagacattgtattgcaatgtcatctatgtgaccaatcgtgttattattgtcatcaatatggttgatatgagttggtttgaaatttgaaggataaggtta |
10275679 |
T |
 |
| Q |
122 |
nnnnnnttattttgcttagtccacgacatgaattgatgttaggtatctttacacatttttggctattttttggtacggcaaggatcaatgttttatatca |
221 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||| |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
10275680 |
aaaaaattattttgcttagtccaagacatgaattgatgtta--tatctttacacgtttttggct-ttttttcgtacagcaaggatcaatgttttatatca |
10275776 |
T |
 |
| Q |
222 |
gtataa |
227 |
Q |
| |
|
|||||| |
|
|
| T |
10275777 |
gtataa |
10275782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University