View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_43 (Length: 241)
Name: NF3825_low_43
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_43 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 16 - 226
Target Start/End: Complemental strand, 5939474 - 5939264
Alignment:
| Q |
16 |
cagaaaaatatatatgcaatccactttcaggggaggtgccaatggaatgtttatcagcaaaaactcttagtggaagatcattcagaaactcaacaaacag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5939474 |
cagaaaaatatatatgcaatccactttcaggggaggtgccaatggaatgtttatcagcaaaaactcttagtggaagatcattcagaaactcaacaaacag |
5939375 |
T |
 |
| Q |
116 |
aatcacaatgtctgctcctcttgtttattctgcaagacatattcaaatgaagccatcaatttacacacatgaagatgtttctcttaaatttccaattcca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5939374 |
aatcacaatgtctgctcctcttgtttattctgcaagacatattcaaatgaagccatcaatttacacacatgaagatgtttctcttaaatttccaattcca |
5939275 |
T |
 |
| Q |
216 |
ggttcatatgc |
226 |
Q |
| |
|
||||||||||| |
|
|
| T |
5939274 |
ggttcatatgc |
5939264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 24 - 111
Target Start/End: Original strand, 6894408 - 6894495
Alignment:
| Q |
24 |
tatatatgcaatccactttcaggggaggtgccaatggaatgtttatcagcaaaaactcttagtggaagatcattcagaaactcaacaa |
111 |
Q |
| |
|
|||||||||||||| ||||||||||| || ||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
6894408 |
tatatatgcaatcctctttcaggggaagtaccaatggaatgtttatctgcaaaaactcttagtggaagattatttcaaaactcaacaa |
6894495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University