View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_47 (Length: 236)
Name: NF3825_low_47
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_47 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 38385508 - 38385729
Alignment:
| Q |
1 |
aaaattatcacacgaa-gaagatcagttcccagccaacacatgttttctatatttacaaaccattttttgagtttcttgcaacacaaggaatcacaaata |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38385508 |
aaaattatcacacgaaagaagatcagttcccagccaacacatgttttctatatttacaaaccattttttgagtttcttgcaacacaaggaatcacaaata |
38385607 |
T |
 |
| Q |
100 |
agaagcaatatgcaaaatttacctatgagcattcccaccatgttgataacagcatgagcaaaagaactatcagcattagaatcatgttccacatcgacat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38385608 |
agaagcaatatgcaaaatttacctatgagcattcccaccatgttgataacagcatgagcaaaagaactatcagcattagaatcatgttccacgtcgacat |
38385707 |
T |
 |
| Q |
200 |
tgacgccttctgcagtagtagt |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
38385708 |
tgacgccttctgcagtagtagt |
38385729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University