View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_52 (Length: 225)
Name: NF3825_low_52
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_52 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 44534010 - 44534235
Alignment:
| Q |
1 |
atatgaagatggagatagcatggaagaagatgaaggaggtgttagtagccgttatgaagttgtgacaacaaataaactttcatcaatggacacagttgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44534010 |
atatgaagatggagatagcatggaagaagatgaaggaggtgttagtagccgttatgaagttgtgacaacaaataaactttcatcaatggacacaattgta |
44534109 |
T |
|
| Q |
101 |
tgagacaagataaggaagcttctcattggatgtaaacaaaagacacaaagattgacctaaatcctctacatctgc-gtatcgtgttgtacctgtagaaat |
199 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| ||||||| ||||||| |||||||||||||||| ||||||| |
|
|
| T |
44534110 |
tgagacaagataaggaagcgtctcattggatgtaaacaacagacacaaagattgacctagatcctctgcatctgcagtatcgtgttgtacctatagaaat |
44534209 |
T |
|
| Q |
200 |
ttttagattttgaagagaatttttct |
225 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
44534210 |
ttttagattttgaagagaatttttct |
44534235 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University