View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3825_low_54 (Length: 209)
Name: NF3825_low_54
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3825_low_54 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 2 - 193
Target Start/End: Complemental strand, 33063879 - 33063688
Alignment:
| Q |
2 |
gcatgtcgaagaatatataaattaatattgttacgtgtttaatttggggtcatcatgtggtgcttactatcacgaatcaagagtcggatgaaaatgaacc |
101 |
Q |
| |
|
|||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33063879 |
gcatatcgaaaaatagataaattaatattgttacgtgtttaatttggggtcatcatgtggtgcttactatcacgaatcaagagtcggatgaaaatgaacc |
33063780 |
T |
|
| Q |
102 |
atacaagttgaagttaaaatgaatatgtgaagatacaacagttgatttcaacttagttggtaaataaataataatttctatgtaaatgataa |
193 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33063779 |
agacaagttgaagttaaaatgaatatgtgaagatacaacaattgatttcaacttagttggtaaataaatgataatttctatgtaaatgataa |
33063688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University