View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3825_low_55 (Length: 204)

Name: NF3825_low_55
Description: NF3825
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3825_low_55
NF3825_low_55
[»] chr6 (1 HSPs)
chr6 (17-204)||(15096844-15097034)


Alignment Details
Target: chr6 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 17 - 204
Target Start/End: Complemental strand, 15097034 - 15096844
Alignment:
17 caatttggagtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggttgtattgatggcggggtatgtcggcttgtttaggaagaaggaga 116  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||||||||||||||||||    
15097034 caatttggtgtaccgggcgtggcgatggcgtccgtgttaacgaatatgaacatggtcgtgttgatggcggggtatgtcgggttgtttaggaagaaggaga 15096935  T
117 tgatgttaaagtggcccggct---gcggcggtggcggagggatgatggttgtgagtgaaggtttgggggagttgatgaaattggctgtacc 204  Q
    |||||||||| ||||| || |   ||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||    
15096934 tgatgttaaaatggccgggttgtggcggcggtggcggagggatgatggtggttagtgaaggtttgggggagttgatgaaattggctgtacc 15096844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University