View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3826_high_10 (Length: 242)
Name: NF3826_high_10
Description: NF3826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3826_high_10 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 5636179 - 5636406
Alignment:
| Q |
19 |
gatagaaagcggagatatgtttgattctttgaaaggctatcttcaatatttatgagccatgttagtattaggattttctattaatcattgtatta----g |
114 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5636179 |
gatagaaagtggagatatatttgattctttgaaaggctatcttcaatatttatgagccatgttagtattaggattttctattaatcattgtattaattag |
5636278 |
T |
 |
| Q |
115 |
tcattttcttattatgatggttaagtttgttctttgtaaaacatagcttagataaaccatcattctagtcatctcagatcattgaattcagaattcttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5636279 |
tcattttcttattatgatggttaagtttgttctttgtaaaacatagcttagataaaccatcattctagtcatctcagatcattgaattcagaattcttca |
5636378 |
T |
 |
| Q |
215 |
ctttcttctgattaaaccagtgttctac |
242 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
5636379 |
ctttcttctgattaaaccagtgttctac |
5636406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University