View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3827_low_13 (Length: 341)
Name: NF3827_low_13
Description: NF3827
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3827_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 9e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 9e-92
Query Start/End: Original strand, 155 - 329
Target Start/End: Original strand, 7823063 - 7823237
Alignment:
| Q |
155 |
gttgtgtatggacgttgctatcagagcagcagttgtgggagttataatgataccaacccacgtgaactttagaacaaagtctctgcttgcttttacttgc |
254 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7823063 |
gttgtgtatggacgttgcaatcagagcagcagttgtgggagttataatgataccaacccacgtgaactttagaacaaagtctctgcttgcttttacttgc |
7823162 |
T |
 |
| Q |
255 |
tctgatttcatctgattctgttttctaccaagcaccaacccttatcattcaggtttcttccacccacttgatatt |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7823163 |
tctgatttcatctgattctgttttctaccaagcaccaacccttatcattcaggtttcttccacccacttgatatt |
7823237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 60 - 90
Target Start/End: Original strand, 7822968 - 7822998
Alignment:
| Q |
60 |
tgatttttgaagttcattccatgcctagctg |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7822968 |
tgatttttgaagttcattccatgcctagctg |
7822998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University